PrimeronReadingFramesandPhase.ppt

Primer on Reading Frames and PhaseWilson Leung08/20163 reading frames per strand(+/-)Frame:base to start translation relative to the first base of the sequence1:Start translation at first base of sequence2:Start translation at second base of sequence3:Start translation at third base of sequenceA genomic sequence has 6 reading frames123FramesA codon could be derived from nucleotides in adjacent exonsCTGAGATTT CCGGATPhase 0Phase 0Spliced mRNAGATPhase 1Phase 2Phase 2Phase 1DonorAcceptorIntronGTAG CTGAGAGATTTT CCGGAT TTT CCGGTAG CTGAGATTT CCGGTAG CTGAGAGATSplice donor and acceptor phasesPhase:Number of bases between the complete codon and the splice siteDonor phase:Number of bases between the end of the last complete codon and the splice donor site(GT/GC)Acceptor phase:Number of bases between the splice acceptor site(AG)and the start of first complete codonPhase depends on the reading frame of the CDSPhase depends on the reading frameAcceptor phase:Phase 2 relative to frame 1Phase 0 relative to frame 2Phase 1 relative to frame 3Splice acceptorPhase depends on the reading frameAcceptor phase:Phase 2 relative to frame 1Phase 0 relative to frame 2Phase 1 relative to frame 3Splice acceptorCompatibility of donor and acceptor siteDonor and acceptor phases of adjacent exons must be compatible with each other:Donor phase+acceptor phase=0 or 3GTAG CCAAATGCTCGATTTPNVLDTranslation:CCAAATGCTCGATGTTCCAAATCTCGATTTIncompatible donor and acceptor phases introduce a frame shift in the translationCCAGTAG AATGCTCGATTTPNGFSTranslation:GTCCAAATTCGATGGTTTCPhase 0 donor site is incompatible with phase 2 acceptor siteCalculating the exon acceptor phasewhere:i 1Pi=Acceptor phase of exon i Li-1=Length of previous exonPi-1=Acceptor phase of previous exonLi-1-Pi-1=Previous exon length starting from the first complete codon(Li-1-Pi-1)%3=Donor phase of previous exon3-(Li-1-Pi-1)%3)=Acceptor phase of current exon(3-(Li-1-Pi-1)%3)%3=Change to phase 0 if acceptor phase is 3Questions?http:/