分子生物学全套.ppt

《分子生物学全套.ppt》由会员分享，可在线阅读，更多相关《分子生物学全套.ppt（96页珍藏版）》请在淘文阁 - 分享文档赚钱的网站上搜索。

1、分分 子子 生生 物物 学学Molecular BiologyPresumed that you have learned“Molecular Biology”before your receiving the Bachelors Degree of Sciences;Designed for helping you to become associated with the most researching interests(areas)of our university;Molecular Biology:The biology(structure and function)of mac

2、ro-moleculesProteinNucleic acid(DNA/RNA/Coding-/non-coding/functional/junk/.Fatty acidPolysaccharide(sugar)Small molecules FOCUSing on NUCLEIC ACID;Molecular GeneticsDNA Sequrncing Cost:Expensive morderately expensive relatively cheap Speed:Time consumming below endurnce fast Effeciency:Low fast-hig

3、h throughput Method:PAGE+autoradiography automatic massively paralellreversible chain termination+length based detection-in situ amplification+fluorescene detection Generation:1st 2nd 3rd(so called next generation)DNA cloning:Have to Cloning+PCR PCR only(highly effecient way).:.Then what?ROCHE Strat

4、egyEmulsion PCR;1 fragment/beadPrimerdNTP(each)PolymeraseTemplatePCR amplification(Chain extension)Emulsion breakingTemplate dissociationEmulsion PCR:1 2-2n;synchronically,Amplification(PCR)+SeparationNot clearly demonstratedPicoTiterPlatePyrosequencing:Templates are prepared by emPCR,with 12 millio

5、n beads deposited into PTP wells.Smaller beads with attached sulphurylase and luciferase surround the template beads.Individual dNTPs flow sequentially across the wells,dispensed in a predetermined order.On incorporation of the complement dNTP,released PPi is converted to ATP,producing light from th

6、e oxidation of luciferin to oxyluciferin.Reads averaging 400 bases are recorded as flowgrams.For homopolymer repeats up to six nucleotides,the number of dNTPs added is directly proportional to the light signal.Insertions are the most common error type,followed by deletions.adenosine5-phosphosulphate

7、+sulphateScanning+ComputerThe recorded is the sequence of dNTP flow;FLOWGRAM;Reads averaging 400 bases;Homopolymer repeats up to six nucleotides;The number of dNTPs added is directly proportional to the light signal,with fluctuation.Reads,nottemplateDNAn+dNTPpolymeraseDNAn+1+PPitemplatePrimerextensi

8、onadenosine-5-phosphosulfate,APS+ATP(+sulfate)Sulfurylase+luciferinluciferaseLight+oxylufiferinRecordedbycomputerOversupplieddNTPApyrasedNDP+dNMP+PiADP+AMP+PiIn one tube in one machineAutomated processLight strength is absolutely proportional to ATP,thus to PPi to base on the template Sequence:TTGCA

9、AAACCCCLSdNTPaddedinserialACGTGPyrographMachine+KitSequencing by ligation:Applied Biosystems Around 100 million emPCR-prepared template beads are deposited onto a glass slide.On annealing of a universal primer,a library of 1,2-probes is added.Appropriate conditions enable selective hybridization and

10、 ligation of probes to complementary positions.The first(Y)and second(Z)positions of the 1,2-probes are designed as interrogation bases,such that the 16 dinucleotides are encoded by four dyes.Following four-colour imaging,the ligated 1,2-probes are chemically cleaved to generate a 5-PO4 group(P).The

11、 cycle of hybridization,ligation,imaging,and cleavage is repeated six more times.The extended primer is then stripped from the templates,and a second ligation round is performed with an n1 primer,which resets the interrogation bases one position to the left.Interrogating each base twice improves the

12、 accuracy of the colour call.Seven ligation cycles ensue,followed by three more ligation rounds.A string of 35 data bits,encoded in colour space,are then aligned to a reference genome to decode the DNA sequence.Substitutions are the most common error type.4 two base combinations each colorfor a give

13、n sequence,1 combination is true and detectable explain the color space alignment with reference5 colors-25 bases unique in genomerepeats?The same as others polony20 micronsPosition overlappedone base one imagecolor order=base adding order=sequence Reversible terminators:IlluminaBridgeamplificationo

14、fDNAfragmentsisrandomlydistributedacrosseightchannelsofaglassslide,towhichhigh-densityforwardandreverseprimersarecovalentlyattached.Thesolid-phaseamplificationproduces80millionmoleculeclusters(MCs)fromindividualssDNAtemplates.AprimerisannealedtothefreeendsoftemplatesineachMC.Thepolymeraseextendsandt

15、henterminatesDNAsynthesisfromasetoffourreversibleterminators(RTs),eachlabeledwithadifferentdye.UnincorporatedRTsarewashedaway,baseidentificationisperformedbyfour-colourimaging,andblockinganddyegroupsareremovedbychemicalcleavagetopermitthenextcycle.ColourimagesforagivenMCprovidereadsof45bases.Substit

16、utionsarethemostcommonerrortype.Single molecule sequencing with RTs:HelicosBillionsofunamplifiedssDNAtemplatesarepreparedwithpoly(dA)tailsthathybridizetopoly(dT)primerscovalentlyattachedtoaglassslide.Forone-passsequencing,thisprimertemplatecomplexissufficient.Two-passsequencinginvolvescopyingthetemp

17、latestrand,removingtheoriginaltemplate,andannealingaprimerdirectedtowardsthesurface.UnlikeIlluminasRTs,thefourHelicosRTsarelabeledwiththesamedyeanddispensedindividuallyinapredeterminedorder.Anincorporationeventresultsinafluorescentsignal.Theproblemofdephasing,inwhichthousandsofcopiedtemplateswithina

18、givenMCdonotextendtheirprimersefficiently,iseliminatedusingsinglemolecules.Deletions,themostcommonerrortype,canbegreatlyreducedbytwo-passsequencingproviding25baseconsensusreads.OneyearAdvanced machineSpecific chemicles and tools of bioinformatics Fool proof worksCore technique(sequence reading)in de

19、velopmentEffectice for the genomes bearing less repeats and being small,e.g.,bacteria;fungi;nematode;microalgae?For larger genomes,resequencing with exceptional Chinese trialsEST analysis(Chinese)Transcriptome profiling(SAGE based)(Chinese)alternativesplicingSerial analysis of gene expression,SAGECA

20、TGGTACAAAAAAAAATTTTTTTTTGGATGNNNNNNNNNCCTACNNNNNNNNNNNNNFok IGGATGCCTACCATGGTACAAAAAAAAATTTTTTTTTAnchoring REAAAAAAAAATTTTTTTTTAAAAAAAAATTTTTTTTTCATGGTACCATGGTACGGATGCCTACTagging REGGATGCCTACGGATGCCTACCATGGTACCATGGTACFill inXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAALigationYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY

21、YYYYYYGTACCATGGTACCTAGGTAGGCATCCGTAGGCATCCBB+other productsPCR w/AB primer,Cut with A REPurification,LigationCATGGTACXXXXXXXXXXXXXXXXXXYYYYYYYYYYYYYYYYYYCATGGTACNCloning,sequencingTag pickingTags w/abundanceinformation Divide into two aliquots,adaptor A and B GGATG CATG XXXXXXXXXCCTAC GTAC XXXXXXXXX

22、PCR amplificationSequencingSAGE based transcriptome profilingGGATG CATG XXXXXXXXXCCTAC GTAC XXXXXXXXXPCR amplificationPCR amplificationSequencingSAGE based transcriptome profilingMolecular Ecology(2008)17,22082218100-1000-1000 sites(T and S)1-10-100 genesOnly questions are what kind of gene or gene

23、combinatin;and length of gene apropriate for both phylogenetic analysis and sequencing Metagenome/environment genomeSequrecing small genome,e.g.,bacteria;fungi;nematode;microalgae;and larger genomes,e.g.,ablone,casava(only Chinese trials)Large Genome Resequencing4humanindividualsincludingaHanChinese

24、(HuanmingYanghimself)Latestpaper:JimJIetal.,2009.8.20,Ahighlyannotatedwhole-genomesequenceofaKoreanindividual.Nature460:1011-1016(integratedmethodology)Reference dependentSummary tracks in the Resembl browserscalealignabilityaligning depthvariationsingletonNA18507Anomalous long-insert read pairs(ora

25、nge lines denote DNA fragment;blocks at either end denote each read);the data indicate loss of 1.3 kb in NA18507 relative to the referenceNA18507Reference from DATABASENA18507Reference from DATABASEAnomalous short-insert pairs of two types indicate an inverted sequence flanked by two insertionsNA185

26、07Reference from DATABASENormal short-insert read-pair alignments(each green line denotes the extent of the reference that is covered by the short fragment,including the two reads)Short DNA fragments are generated,for example,by random shearing and joined to a pair of oligonucleotides in a forked ad

27、aptor configuration.The ligated products are amplified using two oligonucleotide primers,resulting in double-stranded blunt-ended material with a different adaptor sequence on either endFormationofclonalsingle-moleculearray.DNA fragments prepared as above are denatured and single strands are anneale

28、d to complementary oligonucleotides on the flow-cell surface(hatched).A new strand(dotted)is copied from the original strand in an extension reaction that is primed from the end of the surface-bound oligonucleotide;the original strand is then removed by denaturation.The adaptor sequence at the end o

29、f each copied strand is annealed to a new surface-bound complementary oligonucleotide,forming a bridge and generating a new site for synthesis of a second strand(dotted).Multiple cycles of annealing,extension and denaturation in isothermal conditions result in growth of clusters,each,1 mm in physica

30、l diameter.TheDNAineachclusterislinearizedbycleavagewithinoneadaptorsequence(gapmarkedbyanasterisk)anddenatured,generatingsingle-strandedtemplateforsequencingbysynthesistoobtainasequenceread(read1;thesequencingproductisdotted).Toperformpaired-readsequencing,theproductsofread1areremovedbydenaturation

31、,thetemplateisusedtogenerateabridge,thesecondstrandisre-synthesized(showndotted),andtheoppositestrandisthencleaved(gapmarkedbyanasterisk)toprovidethetemplateforthesecondread(read2).Long-rangepaired-endsamplepreparationTosequencetheendsofalong(forexample,.1kb)DNAfragment,theendsofeachfragmentaretagge

32、dbyincorporationofbiotinylated(B)nucleotideandthencircularized,formingajunctionbetweenthetwoends.CircularizedDNAisrandomlyfragmentedandthebiotinylatedjunctionfragmentsarerecoveredandusedasstartingmaterialinthestandardsamplepreparationprocedureillustratedinslide43.Theorientationofthesequencereadsrela

33、tivetotheDNAfragmentisshown(magentaarrows).Whenalignedtothereferencesequence,thesereadsareorientedwiththeir5endstowardseachother(incontrasttotheshortinsertpairedreadsproducedasshowninslide43)NolibrarynecessaryGenome size:total length of DNA molecules in a haplotypic cell,e.g.,44/2=22 autosomes+X+YGe

34、nome complexity:all unique sequences+1 copy of the repeats single copyrepeatedrepeatedinvertedinverteddeletedspecific structuresmall scaled structureIf no referenceIf only normal short insert pair readsChinese company favoriteset of trials;no outport yet454 better than others;longer reads.All de nov

35、o whole genome sequencing published todate,automatic high throughput 96 well sequencer,the same as human genome sequencingeven being stingy for 454,400bp in average,stingyenough for EST and transcriptomer profilingappropriate for bacteria and fungi and microalgae?otherwise,reference availbale insert

36、edMolecular inversion probes,forexample,usedforlarge-scalesequencecaptureareusuallysingle-strandedandaround70nucleotidesinlength,composedofauniversalcoreof30nucleotides,whichisflankedbyspecific20-nucleotidetargetingsequencesoneachside.Thetargetingsequencesaredesignedtohybridizetospecificgenomicregio

37、nsupstreamanddownstreamofasequenceofinterest.Afterhybridizationinsolution,polymeraseisusedtocopythetargetedregion,andboththeprobeandcopiedregionarecircularizedthroughtheaddi-tionofligase.Theinitialworkin2007dem-onstratedcaptureofnearly10,000humanexonsinasinglemultiplexreaction.Nextgenerationsequenci

38、ngtechnologieshavebroughtaboutgreatimprovementsinsequencingthroughputandcost,butdonotyetallowfordenovosequencingoflargerepetitivegenomes.Astrategythatcombinescuttingedgenextgenerationsequencingwith“oldschool”genomicsresourcesandallowsrapidcost-effectivesequencingoflargegenomes.of OryzasequenceBACCan

39、 we see the DNA molecule,and count the bases one by one?Possible in near future.Scanning tunneling microscopy(STM)a powerful technique for viewing surfaces at the atomic level.The STM is based on the concept of quantum tunnelling.When a conducting tip is brought very near to a metallic or semiconduc

40、ting surface,a bias between the two can allow electrons to tunnel through the vacuum between them.For low voltages,this tunneling current is a function of the local density of states of the sample.Variations in current as the probe passes over the surface are translated into an image.STM can be a ch

41、allenging technique,as it requires extremely clean surfaces,sharp tips and stable environment.Its development in 1981 earned its inventors,Gerd Binnig and Heinrich Rohrer,the Nobel Prize in 1986.The components of an STM include scanning tip,piezoelectric controlled height and x,y scanner,coarse samp

42、le-to-tip control,vibration isolation system,and computer.The resolution of an image is limited by the radius of curvature of the scanning tip of the STM.Additionally,image artifacts can occur if the tip has two tips at the end rather than a single atom;this leads to“double-tip imaging”Therefore it

43、has been essential to develop processes for consistently obtaining sharp,usable tips.Recently,carbon nanotubes have been used in this instance.The tip is often made of tungsten or platinum-iridium,though gold is also used.Tungsten tips are usually made by electrochemical etching,and platinum-iridium

44、 tips by mechanical shearing.Due to the extreme sensitivity of tunnel current to height,proper vibration isolation is imperative for obtaining usable results.In the first STM by Binnig and Rohrer,magnetic levitation was used to keep the STM free from vibrations;now spring systems are often used.Addi

45、tionally,mechanisms for reducing eddy current are implemented.Maintaining the tip position with respect to the sample,scanning the sample in raster fashion and acquiring the data is computer controlled.The computer is also used for enhancing the image with the help of image processing as well as per

46、forming quantitative morphological measurements.STM imaging and spectroscopy of single-stranded peptide nucleic acid(ssPNA)and DNA adsorbed on a Cu(111)surfaceAwide-areaimageofFITC-modifiedssPNA(FITCTTGACCAhigh-magnificationimageofssPNAandamodelofthismoleculeThedI/dVspectrameasuredfromthemarkermolec

47、ules,theindividualnucleobasesandtheCu(111)substrate.fluorescent dyemolecule fluorescein isothiocyanate(FITC)peptide nucleic acid(PNA)A typical wide-area image of FITC-modified DNA(FITCTTGGCCA high-magnification image of a single FITCTTGGCC molecule and a model of this molecule in vacuumThe dI/dV spe

48、ctra measured from the two adjacent bright nucleobases and the Cu(111)substrateDepositionandSTManalysisofsingle-strandedM13mp18DNAmoleculesonaCu(111)surfaceSchematicillustrationoftheobliqueinjectionmethod.DNAstrandstendtoalignmoreperpendicularthanhorizontaltotheflow(injection)directionTypicalwide-ar

49、eaimageofM13mp18AnenlargedviewoftherectangularregionAdI/dVmapofthesameregionasabove,themaximizeddetectionofthedensityofstatesofguaninePartofthebasesequenceofM13mp18contaminantsGCAIR BREAK!Hopeisbehindtheislandoroversea.Back to the traditional approachesThalassiosira pseudonanaWholegenomeshotgunseque

50、ncingstrategyAmostrelativeandsimplestexampleHierarchical(BACbyBAC)genomesequencingstrategylatter;moreknowledgebackgroundneeded34millionbasepairnucleargenome129thousandbasepairplastidgenome44thousandbasepairmitochondrialgenome24diploidnuclearchromosomesnovelgenesforsilicicacidtransportandformationofs